Introduction

nf-core/taxprofiler is a pipeline for highly-parallelised taxonomic classification and profiling of shotgun metagenomic data across multiple tools simultaneously. In addition to multiple classification and profiling tools, at the same time it allows you to performing taxonomic classification and profiling across multiple databases and settings per tool, as well as produces standardised output tables to allow immediate cross comparison of results between tools.

In addition to this page, you can find additional usage information on the following pages:

General Usage

To run nf-core/taxprofiler, at a minimum two you require two inputs:

  • a sequencing read samplesheet
  • a database samplesheet

Both contain metadata and paths to the data of your input samples and databases.

When running nf-core/taxprofiler, every step and tool is ‘opt in’. To run a given classifier or profiler you must make sure to supply both a database in your <database>.csv and supply --run_<profiler> flag to your command. Omitting either will result in the profiling tool not executing.

nf-core/taxprofiler also includes optional pre-processing (adapter clipping, merge running etc.) or post-processing (visualisation) steps. These are also opt in with a --perform_<step> flag. In some cases, the pre- and post-processing steps may also require additional files. Please check the parameters tab of this documentation for more information.

Please see the rest of this page for information about how to prepare input samplesheets and databases and how to run Nextflow pipelines. See the parameters documentation for more information about specific options the pipeline also offers.

Samplesheet inputs

nf-core/taxprofiler can accept as input raw or preprocessed single- or paired-end short-read (e.g. Illumina) FASTQ files, long-read FASTQ files (e.g. Oxford Nanopore), or FASTA sequences (available for a subset of profilers). For PACBIO_SMRT data, please convert BAM files to FASTQ format before input.

You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row as shown in the examples below. Furthermore, nf-core/taxprofiler also requires a second comma-separated file of 3 columns with a header row as in the examples below.

This samplesheet is then specified on the command line as follows:

Terminal window
--input '[path to samplesheet file]' --databases '[path to database sheet file]'

Multiple runs of the same sample

The sample identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate different runs FASTQ files of the same sample before performing profiling, when --perform_runmerging is supplied.

Warning

If --perform_runmerging is activated and --shortread_qc_mergepairs is disabled, all runs must have the same endedness (single-end or paired-end). Runs with different endedness must be named uniquely at the sample level and will not be merged.

Below is an example for the same sample sequenced across 3 lanes:

samplesheet.csv
sample,run_accession,instrument_platform,fastq_1,fastq_2,fasta
2612,lane1,ILLUMINA,2612_lane1_R1.fq.gz,2612_lane1_R2.fq.gz,
2612,lane2,ILLUMINA,2612_lane2_R1.fq.gz,2612_lane2_R2.fq.gz,
2612,lane3,ILLUMINA,2612_lane3_R1.fq.gz,,

::: info Please note that the column name run_accession follows the definition of an ENA ‘run’. A ‘run’ corresponds to a single or paired-end set of demultiplexed FASTQs. Given that demultiplexing of a given library happens per lane, each sequencing pair from each lane is a ‘run’. Therefore, for each sample, you may get multiple ‘runs’ consisting of both lanes (of the same library) and sequencing libraries. Therefore ensure that each run_accession ID is unique, even if from the same sample! :::

Warning

Runs of the same sample sequenced on Illumina platforms with a combination of single and paired-end data will not be run-wise concatenated, unless pair-merging is specified. In the example above, run3 will be profiled independently of run1 and run2 if pairs are not merged.

Full samplesheet

The pipeline will auto-detect whether a sample is single- or paired-end using the information provided in the samplesheet. The samplesheet can have as many columns as you desire, however, there is a strict requirement for the first 6 columns to match those defined in the table below.

A final samplesheet file consisting of both single- and paired-end data, as well as long-read FASTA files may look something like the one below. This is for 6 samples, where 2612 has been sequenced twice.

samplesheet.csv
sample,run_accession,instrument_platform,fastq_1,fastq_2,fasta
2611,ERR5766174,ILLUMINA,,,/<path>/<to>/fasta/ERX5474930_ERR5766174_1.fa.gz
2612,ERR5766176,ILLUMINA,/<path>/<to>/fastq/ERX5474932_ERR5766176_1.fastq.gz,/<path>/<to>/fastq/ERX5474932_ERR5766176_2.fastq.gz,
2612,ERR5766180,ILLUMINA,/<path>/<to>/fastq/ERX5474936_ERR5766180_1.fastq.gz,,
2613,ERR5766181,ILLUMINA,/<path>/<to>/fastq/ERX5474937_ERR5766181_1.fastq.gz,/<path>/<to>/fastq/ERX5474937_ERR5766181_2.fastq.gz,
ERR3201952,ERR3201952,OXFORD_NANOPORE,/<path>/<to>/fastq/ERR3201952.fastq.gz,,
Warning

Input FASTQ and FASTA files must be gzipped.

Warning

While one can include both short-read and long-read data in one run, we recommend that you split these across two pipeline runs and database sheets (see below). This will allow classification optimisation for each data type, and make MultiQC run-reports more readable (due to run statistics having vary large number differences).

Column Description
sample Unique sample name [required].
run_accession Run ID or name unique for each (pairs of) file(s) .Can also supply sample name again here, if only a single run was generated [required].
instrument_platform Sequencing platform reads generated on, selected from the EBI ENA controlled vocabulary [required].
fastq_1 Path or URL to sequencing reads or for Illumina R1 sequencing reads in FASTQ format. GZipped compressed files accepted. Can be left empty if data in FASTA is specified. Cannot be combined with fasta.
fastq_2 Path or URL to Illumina R2 sequencing reads in FASTQ format. GZipped compressed files accepted. Can be left empty if single end data. Cannot be combined with fasta.
fasta Path or URL to long-reads or contigs in FASTA format. GZipped compressed files accepted. Can be left empty if data in FASTA is specified. Cannot be combined with fastq_1 or fastq_2.

An example samplesheet has been provided with the pipeline.

Warning

FASTA input will not go through any preprocessing steps, and will go directly to profiling.

Full database sheet

nf-core/taxprofiler supports multiple databases being classified/profiled against in parallel for each tool.

Databases can be supplied either in the form of a compressed .tar.gz archive of a directory containing all relevant database files or the path to a directory on the filesystem.

Warning

nf-core/taxprofiler does not provide any databases by default, nor does it currently generate them for you. This must be performed manually by the user. See bottom of this section for more information of the expected database files, or the building databases tutorial.

The pipeline takes the paths and specific classification/profiling parameters of the tool of these databases as input via a four (or five) column comma-separated sheet.

The optional db_type column allows to use specific database/parameters against specific data types. By specifying if a database is for short-or long-reads (or even both), the samples sequenced with Illumina are combined with the short-read databases and the samples sequenced with Nanopore are combined with long-read databases. If db_type is not provided, it is assumed the database and parameters are applicable for both short- and long-read data.

Warning

To allow user freedom, nf-core/taxprofiler does not check for mandatory or the validity of non-file database parameters for correct execution of the tool - excluding options offered via pipeline level parameters! Please validate your database parameters (cross-referencing parameters, and the given tool documentation) before submitting the database sheet! For example, if you don’t use the default read length - Bracken will require -r <read_length> in the db_params column.

An example database sheet can look as follows, where 7 tools are being used, and malt and kraken2 will be used against two databases each. Since the db_type column is missing, it is therefore assumed that the database and parameters are suitable for both short- and long-read data.

In the second example database sheet, the db_type column has been provided. The valid options are short, long and short;long.

kraken2 will be run twice even though only having a single ‘dedicated’ database because specifying bracken implies first running kraken2 on the bracken database, as required by bracken.

tool,db_name,db_params,db_path
malt,malt85,-id 85,/<path>/<to>/malt/testdb-malt/
malt,malt95,-id 90,/<path>/<to>/malt/testdb-malt.tar.gz
bracken,db1,;-r 150,/<path>/<to>/bracken/testdb-bracken.tar.gz
kraken2,db2,--quick,/<path>/<to>/kraken2/testdb-kraken2.tar.gz
krakenuniq,db3,,/<path>/<to>/krakenuniq/testdb-krakenuniq.tar.gz
centrifuge,db1,,/<path>/<to>/centrifuge/minigut_cf.tar.gz
centrifuger,db1,,/<path>/<to>/centrifuger/testdb_centrifuger.tar.gz
metaphlan,db1,,/<path>/<to>/metaphlan/metaphlan_database/
motus,db_mOTU,,/<path>/<to>/motus/motus_database/
ganon,db1,,/<path>/<to>/ganon/test-db-ganon.tar.gz
kmcp,db1,;-I 20,/<path>/<to>/kmcp/test-db-kmcp.tar.gz
sylph,db1,-m 80,/<path>/<to>/sylph/test-db-sylph.tar.gz
melon,db1,,/<path>/<to>/melon/test-db-melon.tar.gz
metacache,db1,,/<path>/<to>/metacache/test-db-metacache.tar.gz
tool,db_name,db_params,db_type,db_path
malt,malt85,-id 85,short,/<path>/<to>/malt/testdb-malt/
malt,malt95,-id 90,short,/<path>/<to>/malt/testdb-malt.tar.gz
bracken,db1,;-r 150,short,/<path>/<to>/bracken/testdb-bracken.tar.gz
kraken2,db2,--quick,short,/<path>/<to>/kraken2/testdb-kraken2.tar.gz
krakenuniq,db3,,short;long,/<path>/<to>/krakenuniq/testdb-krakenuniq.tar.gz
centrifuge,db1,,short,/<path>/<to>/centrifuge/minigut_cf.tar.gz
centrifuger,db1,,short,/<path>/<to>/centrifuger/testdb_centrifuger.tar.gz
metaphlan,db1,,short,/<path>/<to>/metaphlan/metaphlan_database/
motus,db_mOTU,,long,/<path>/<to>/motus/motus_database/
ganon,db1,,short,/<path>/<to>/ganon/test-db-ganon.tar.gz
kmcp,db1,;-I 20,short,/<path>/<to>/kmcp/test-db-kmcp.tar.gz
sylph,db1,-m 80,long,/<path>/<to>/sylph/test-db-sylph.tar.gz
melon,db1,,long,/<path>/<to>/melon/test-db-melon.tar.gz
metacache,db1,,long,/<path>/<to>/metacache/test-db-metacache.tar.gz
Warning

For Bracken, KMCP and sylph, which are two step profilers, nf-core/taxprofiler has a special way of passing parameters to each steps!

For Bracken, if you wish to supply any parameters to both the Kraken or Bracken steps or just the Bracken step, you must have a semi-colon ; list in the db_params column. This allows you to specify the Kraken2 parameters before and Bracken parameters after the ;. This is particularly important if you supply a Bracken database with a non-default read length parameter. If you do not have any parameters to specify, you can leave this column empty. If you wish to provide settings to just the Kraken2 step of the Bracken profiling, you can supply a normal string to the column without a semi-colon. If you wish to supply parameters to only Bracken (and keep default Kraken2 parameters), then you supply a string to the column starting with ; and the Bracken parameters after.

Similarly, for KMCP, if you want to supply parameters for both the first (KMCP search) and the second step (KMCP profile) steps, you must have a semi-colon separated; list in db_params. If you wish to provide parameters to just KMCP search, you do not need the ;. If you want to supply parameters to just KMCP profile (and keep search parameters at default), then you must start the string with ; and the KMCP profile parameters come after the semi colon. If you do not wish to modify any parameters, you can leave the column empty (i.e. the ; is not necessary).

This allows you to specify the KMCP search and the KMCP profile parameters, separated by ;. If you do not have any parameters to specify, you can leave this as empty.

The logic is the same for sylph classifier. If you want to supply parameters for both the first (sylph profile) and the second step (sylph-tax taxprof), you must have a semi-colon separated; list in db_params. If you wish to provide parameters to just sylph profile, you do not need the ;. If you want to supply parameters to just sylph-tax taxprof (and keep sylph profile parameters at default), then you must start the string with ; and the sylph-tax taxprof parameters come after the semi colon. If you do not wish to modify any parameters, you can leave the column empty (i.e. the ; is not necessary).

Column specifications are as follows:

Column Description
tool Taxonomic profiling tool (supported by nf-core/taxprofiler) that the database has been indexed for [required]. Please note that bracken also implies running kraken2 on the same database.
db_name A unique name per tool for the particular database [required]. Please note that names need to be unique across both kraken2 and bracken as well, even if re-using the same database.
db_params Any parameters of the given taxonomic classifier/profiler that you wish to specify that the taxonomic classifier/profiling tool should use when profiling against this specific database. Can be empty to use taxonomic classifier/profiler defaults. Must not be surrounded by quotes [required]. We generally do not recommend specifying parameters here that turn on/off saving of output files or specifying particular file extensions - this should be already addressed via pipeline parameters. For Bracken databases, must at a minimum contain a ; separating Kraken2 from Bracken parameters.
db_type An optional column to distinguish between short- and long-read databases. If the column is empty, the pipeline will assume all databases (and their settings specified in db_params!) will be applicable for both short and long read data. Possible values: long, short, or short;long. If the db_type column is missing from the database.csv, it will take the default value short;long
db_path Path to the database. Can either be a path to a directory containing the database index files or a .tar.gz file which contains the compressed database directory with the same name as the tar archive, minus .tar.gz [required].
Tip

You can also specify the same database directory/file twice (ensuring unique db_names) and specify different parameters for each database to compare the effect of different parameters during classification/profiling.

nf-core/taxprofiler will automatically decompress and extract any compressed archives for you.

The optional db_type column enables the use of specific databases or parameters for different data types. By specifying if a database is for short-reads, long-reads, or both, Illumina samples are combined with short-read databases, while Nanopore samples are combined with long-read databases.

Tip

Click the links in the list below for short quick-reference tutorials how to generate download ‘pre-made’ and/or custom databases for each tool.

The (uncompressed) database paths (db_path) for each tool are expected to contain:

  • Bracken: output of the combined kraken2-build and bracken-build process.
  • Centrifuge: output of centrifuge-build.
  • Centrifuger: output of centrifuger-build.
  • DIAMOND: output of diamond makedb.
  • Kaiju: output of kaiju-makedb.
  • Kraken2: output of kraken2-build command(s).
  • KrakenUniq: output of krakenuniq-build command(s).
  • MALT output of malt-build.
  • MetaPhlAn: output of with metaphlan --install or downloaded from links on the MetaPhlAn wiki.
  • mOTUs: the directory db_mOTU/ that is downloaded via motus downloadDB
    • Important: only mOTUs v3 currently supported.
    • Note that you must use motus downloadDB and if installed via conda, will be placed in a specific site-package directory in the conda environment. For more details see the mOTUs database tutorial.
  • ganon: output of ganon build or ganon build-custom.
  • KMCP: output of kmcp index. Note: kmcp index uses the output of an upstream kmcp compute step.
  • sylph: output of sylph sketch command.
  • Melon: output of diamond makedb and minimap2.
  • MetaCache: output of metacache build command

Running the pipeline

The typical command for running the pipeline is as follows:

nextflow run nf-core/taxprofiler --input samplesheet.csv --databases databases.csv --outdir <OUTDIR> -profile docker --run_<TOOL1> --run_<TOOL2>

This will launch the pipeline with the docker configuration profile. See below for more information about profiles.

When running nf-core/taxprofiler, every step and tool is ‘opt in’. To run a given classifier/profiler you must make sure to supply both a database in your <database>.csv and supply --run_<profiler> flag to your command. Omitting either will result in the classification/profiling tool not executing. If you wish to perform pre-processing (adapter clipping, merge running etc.) or post-processing (visualisation) steps, these are also opt in with a --perform_<step> flag. In some cases, the pre- and post-processing steps may also require additional files. Please check the parameters tab of this documentation for more information.

Note that the pipeline will create the following files in your working directory:

work # Directory containing the nextflow working files
<OUTDIR> # Finished results in specified location (defined with --outdir)
.nextflow_log # Log file from Nextflow
# Other nextflow hidden files, eg. history of pipeline runs and old logs.

If you wish to repeatedly use the same parameters for multiple runs, rather than specifying each flag in the command, you can specify these in a params file.

Pipeline settings can be provided in a yaml or json file via -params-file <file>.

Warning

Do not use -c <file> to specify parameters as this will result in errors. Custom config files specified with -c must only be used for tuning process resource specifications, other infrastructural tweaks (such as output directories), or module arguments (args). In particular do not use -c to provide ext.args for KrakenUniq for customising --preload-size values, as this will override any references to this parameter in --databases.

The above pipeline run specified with a params file in yaml format:

nextflow run nf-core/taxprofiler -profile docker -params-file params.yaml

with:

params.yaml
input: './samplesheet.csv'
outdir: './results/'
<...>

You can also generate such YAML/JSON files via nf-core/launch.

Sequencing quality control

FastQC gives general quality metrics about your reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. nf-core taxprofiler offers falco as an drop-in replacement, with supposedly better improvement particularly for long reads.

Preprocessing Steps

nf-core/taxprofiler offers four main preprocessing steps for preprocessing raw sequencing reads:

Info

You can save the ‘final’ reads used for classification/profiling from any combination of these steps with --save_analysis_ready_fastqs.

Read Processing

Raw sequencing read processing in the form of adapter clipping and paired-end read merging can be activated via the --perform_shortread_qc or --perform_longread_qc flags.

It is highly recommended to run this on raw reads to remove artifacts from sequencing that can cause false positive identification of taxa (e.g. contaminated reference genomes) and/or skews in taxonomic abundance profiles. If you have public data, normally these should have been corrected for, however you should still check that these steps have indeed been already performed.

Short reads

There are currently two options for short-read preprocessing: fastp or adapterremoval.

For adapter clipping, you can either rely on the tool’s default adapter sequences, or supply your own adapters (--shortread_qc_adapter1 and --shortread_qc_adapter2) By default, paired-end merging is not activated. In this case paired-end ‘alignment’ against the reference databases is performed where supported, and if not, supported pairs will be independently classified/profiled. If paired-end merging is activated you can also specify whether to include unmerged reads in the reads sent for classification/profiling (--shortread_qc_mergepairs and --shortread_qc_includeunmerged). You can also turn off clipping and only perform paired-end merging, if requested. This can be useful when processing data downloaded from the ENA, SRA, or DDBJ (--shortread_qc_skipadaptertrim). Both tools support length filtering of reads and can be tuned with --shortread_qc_minlength. Performing length filtering can be useful to remove short (often low sequencing complexity) sequences that result in unspecific classification and therefore slow down runtime during classification/profiling, with minimal gain.

Long reads

There are currently two options for long-read Oxford Nanopore processing: porechop, porechop_abi.

When using porechop_abi, you can enable on the abi option by turning on --longread_qc_predictadapters to predict adapters directly from the reads. Alternatively, you can set --longread_qc_adapterlist to provide a custom adapter list instead of using the default adapters from the Porechop database.

Below is a description of the format for a custom adapter list file:

line 1: Adapter name
line 2: Start adapter sequence
line 3: End adapter sequence
--- repeat for each adapter pair---

An example is:

custom_adapters_list.txt
custom_adapter_1
GGTTGTTTCTGTTGGTGCTGATATTGCT
GAAGATAGAGCGACAGGCAAGT
custom_adapter_2
CACAAAGACACCGACAACTTTCTT
TTCGGATTCTATCGTGTTTCCCTA

If your adapters do not contain the start or end sequence, just put an empty line.

For both short-read and long-read preprocessing, you can optionally save the resulting processed reads with --save_preprocessed_reads.

Redundancy Estimation

Metagenome ‘coverage’ or sequencing complexity estimations of short-read datasets can be activated with --perform_shortread_redundancyestimation.

This turns on checking of read redundancy in a sequencing library using Nonpareil, to provide an estimation of whether you have sequenced enough to capture all possible genomes present in your metagenomic sample (with the assumption that once you’ve sequenced enough, you will keep sequencing PCR amplicons rather than unique reads).

This is only suitable for short-read, and in nf-core/taxprofiler specifically, FASTQ files.

Nonpareil is performed on processed reads (i.e. after fastp or AdapterRemoval). This will run on either the first read of each read pair (as recommended by the authors), or on merged reads.

Before using this tool please note the following caveats:

Warning
  • It is not recommended to keep unmerged (--shortread_qc_includeunmerged) reads when using the calculation.

  • Your shortest reads after processing should not go below 24bp If the ‘kmer’ value is not correct, make sure your shortest reads after processing is not less than 24bp.

    If this is the case you will need to specify in a custom config
    ```nextflow
    process {
    withName: NONPAREIL_NONPAREIL {
    ext.args = { "-k <NUMBER>" }
    }
    }
    ```
    Where `<NUMBER>` should be at least the shortest read in your library

Complexity Filtering

Complexity filtering can be activated via the --perform_shortread_complexityfilter flag.

Complexity filtering is primarily a run-time optimisation step. It is not necessary for accurate taxonomic classification/profiling, however it can speed up run-time of each tool by removing reads with low-diversity of nucleotides (e.g. with mono-nucleotide - AAAAAAAA, or di-nucleotide repeats GAGAGAGAGAGAGAG) that have a low-chance of giving an informative taxonomic ID as they can be associated with many different taxa. Removing these reads therefore saves computational time and resources.

There are currently three options for short-read complexity filtering: bbduk, prinseq++, and fastp.

There are two options for long-read quality filtering: Filtlong and nanoq, with nanoq being the default option.

The tools offer different algorithms and parameters for removing low complexity reads and quality filtering. We therefore recommend reviewing the pipeline’s parameter documentation and the documentation of the tools (see links above) to decide on optimal methods and parameters for your dataset.

You can optionally save the FASTQ output of the run merging with the --save_complexityfiltered_reads. If running with fastp, complexity filtering happens inclusively within the earlier shortread preprocessing step. Therefore there will not be an independent pipeline step for complexity filtering, and no independent FASTQ file (i.e. --save_complexityfiltered_reads will be ignored) - your complexity filtered reads will also be in the fastp/ folder in the same file(s) as the preprocessed read.

Warning

For nanopore data: we do not recommend performing any read preprocessing or complexity filtering if you are using ONTs Guppy toolkit for basecalling and post-processing.

Host-Read Removal

Removal of possible-host reads from FASTQ files prior classification/profiling can be activated with --perform_shortread_hostremoval or --perform_longread_hostremoval.

Similarly to complexity filtering, host-removal can be useful for runtime optimisation and reduction in misclassified reads. It is not always necessary to report classification of reads from a host when you already know the host of the sample, therefore you can gain a run-time and computational advantage by removing these prior typically resource-heavy classification/profiling with more efficient methods. Furthermore, particularly with human samples, you can reduce the number of false positives during classification/profiling that occur due to host-sequence contamination in reference genomes on public databases.

nf-core/taxprofiler currently offers host-removal via minimizer sketching with Deacon for both short and long reads. For short reads, host removal can alternatively be performed via alignment against a reference genome using Bowtie2 or with Hostile that is using pre-defined indices. For long reads, hostile or minimap2 are offered as alternatives to Deacon. The filtered reads are then used for downstream classification/profiling.

For Deacon, Bowtie2, and minimap2, you can supply your reference genome in FASTA format with --hostremoval_reference. You can also optionally supply a directory containing pre-indexed Deacon/Bowtie2 index files with --shortread_hostremoval_index or a minimap2 .mmi file for --longread_hostremoval_index, however nf-core/taxprofiler will generate these for you if necessary. Pre-supplying the index directory or files can greatly speed up the process, and these can be re-used. For Hostile, you specifically need a name of the reference to either download or find the correct files in the index directory.

Tip

If you have multiple taxa or sequences you wish to remove (e.g., the host genome and then also PhiX - common quality-control reagent during sequencing) you can simply concatenate the FASTAs of each taxa or sequences into a single reference file.

Run Merging

For samples that may have been sequenced over multiple runs, or for FASTQ files split into multiple chunks, you can activate the ability to merge across all runs or chunks with --perform_runmerging.

For more information how to set up your input samplesheet, see Multiple runs of the same sample.

Activating this functionality will concatenate the FASTQ files with the same sample name after the optional preprocessing steps and before classification/profiling. Note that libraries with runs of different pairing types will not be merged and this will be indicated on output files with a _se or _pe suffix to the sample name accordingly.

You can optionally save the FASTQ output of the run merging with the --save_runmerged_reads.

Classification and Profiling

The following sections provide tips and suggestions for running the different taxonomic classification and profiling tools within the pipeline. For advice and/or guidance whether you should run a particular tool on your specific data, please see the documentation of each tool!

An important distinction between the different tools in included in the pipeline is classification versus profiling. Taxonomic classification is concerned with simply detecting the presence of species in a given sample. Taxonomic profiling involves additionally estimating the abundance of each species.

Note that not all taxonomic classification tools (e.g. Kraken, MALT, Kaiju) performs profiling, but all taxonomic profilers (e.g. MetaPhlAn, mOTUs, Bracken) must perform some form of classification prior to profiling.

For advice as to which tool to run in your context, please see the documentation of each tool.

Note

If you would like to change this behaviour, please contact us on the nf-core slack and we can discuss this.

Not all tools currently have dedicated tips, suggestions and/or recommendations, however we welcome further contributions for existing and additional tools via pull requests to the nf-core/taxprofiler repository!

Bracken

You must make sure to also activate Kraken2 to run Bracken in the pipeline.

It is unclear whether Bracken is suitable for running long reads, as it makes certain assumptions about read lengths. Furthermore, during testing we found issues where Bracken would fail on the long-read test data.

Therefore currently nf-core/taxprofiler does not run Bracken on data specified as being sequenced with OXFORD_NANOPORE in the input samplesheet.

Bracken currently does support reporting of abundance stats for multiple taxonomic levels at once (by default, it only reports species level hits). You can change the reported taxonomic level by using Bracken’s -l parameter (see Step 3 of the Bracken documentation). If you want to report multiple taxonomic levels, you must specify your Bracken database multiple times in the database sheet, once for each taxonomic level you want to report, and each with a unique database name. For example:

databases.csv
tool,db_name,db_params,db_type,db_path
bracken,db1-species,;-l S,short,https://github.com/nf-core/test-datasets/raw/taxprofiler/data/database/bracken/testdb-bracken.tar.gz
bracken,db1-genus,;-l G,short,https://github.com/nf-core/test-datasets/raw/taxprofiler/data/database/bracken/testdb-bracken.tar.gz
bracken,db1-phylum,;-l P,short,https://github.com/nf-core/test-datasets/raw/taxprofiler/data/database/bracken/testdb-bracken.tar.gz
kraken2,db2,--quick,short,https://github.com/nf-core/test-datasets/raw/taxprofiler/data/database/kraken2/testdb-kraken2.tar.gz

This will produce independent Bracken output files for each taxonomic level, with the suffixes db1-species, db1-genus and db1-phylum respectively in the bracken/<database_name>/ output directories.

Warning

Do not forget to supply the Bracken parameters after the a ; to ensure the -l parameter goes to Bracken and not Kraken! See Full database sheet for more information.

Centrifuge

Centrifuge currently does not accept FASTA files as input, therefore no output will be produced for these input files.

Centrifuger

Centrifuge currently does not accept FASTA files as input, therefore no output will be produced for these input files.

DIAMOND

DIAMOND can only accept a single input read file. When run DIAMOND on paired-end reads without merging, only the read1 file will be used. Alternatively, you can merge the reads using --shortread_qc_mergepairs.

Warning

Note however that the merging approach only works when the vast majority of reads do actually merge. If your DNA molecules were too short, read pairs will not overlap and not merge - by default being discarded. While you have the option of retaining unmerged reads as well (with --shortread_qc_includeunmerged), be careful that including unmerged reads retains these as independent reads in the FASTQ file - thus you may get double counts on a taxon from a single read.

DIAMOND only allows output of a single file format at a time, therefore parameters such --diamond_save_reads supplied will result in only aligned reads in SAM format will be produced, no taxonomic profiles will be available. Be aware of this when setting up your pipeline runs, depending on your particular use case.

Kaiju

Currently, no specific tips or suggestions.

Kraken2

Currently, no specific tips or suggestions.

KrakenUniq

Currently, no specific tips or suggestions.

MALT

MALT does not support paired-end reads alignment (unlike other tools), therefore nf-core/taxprofiler aligns these as independent files if read-merging is skipped. If you skip merging, you can sum or average the results of the counts of the pairs.

Krona can only be run on MALT output if path to Krona taxonomy database supplied to --krona_taxonomy_directory. Therefore if you do not supply the a Krona directory, Krona plots will not be produced for MALT.

MetaPhlAn

MetaPhlAn4 is compatible with the MetaPhlAn3 database by adding the --mpa3 into db_params of the database.csv.

mOTUs

mOTUs currently does not accept FASTA files as input, therefore no output will be produced for these input files. For long reads, the motus prep_long command will be executed first to split long reads into shorter reads which can then be profiled with motus profile command.

ganon

It is unclear whether ganon is suitable for running long reads - during testing we found issues where ganon would fail on the long-read test data.

Therefore currently nf-core/taxprofiler does not run ganon on data specified as being sequenced with OXFORD_NANOPORE in the input samplesheet.

KMCP

KMCP is only suitable for short-read metagenomic profiling, with much lower sensitivity on long-read datasets. Therefore, nf-core/taxprofiler does not currently run KMCP on data specified as being sequenced with OXFORD_NANOPORE in the input samplesheet.

sylph

There are no specific tips or suggestions currently for sylph.

Melon

Melon is only suitable for long-read metagenomic profiling. Therefore, nf-core/taxprofiler does not currently run Melon on data specified as being sequenced with Illumina or any other short-read platform in the input samplesheet.

MetaCache

There are no specific tips or suggestions currently for MetaCache.

Post Processing

Visualisation

nf-core/taxprofiler supports generation of Krona interactive pie chart plots for the following compatible tools.

  • Kraken2
  • Centrifuge
  • Centrifuger
  • Kaiju
  • MALT
Warning

MALT KRONA plots cannot be generated automatically, you must also specify a Krona taxonomy directory with --krona_taxonomy_directory if you wish to generate these.

Multi-Table Generation

The main multiple-sample table from nf-core/taxprofiler is from a dedicated standalone tool originally developed for the pipeline - Taxpasta. When providing --run_profile_standardisation, every classifier/profiler and database combination will get a standardised and (if present) multi-sample taxon table in the taxpasta/ directory. These tables are structured in the same way, to facilitate comparison between the results of the classifier/profiler. If multiple samples are provided, taxpasta merge will be executed, whereas if only a single sample is provided, taxpasta standardise will be executed - the file naming scheme will be the same for both.

In addition to per-sample profiles and standardised Taxpasta output, the pipeline also supports generation of ‘native’ multi-sample taxonomic profiles (i.e., those generated by the taxonomic profiling tools themselves or additional utility scripts provided by the tool authors), when providing --run_profile_standardisation to your pipeline.

These are executed on a per-database level. I.e., you will get a multi-sample taxon table for each database you provide for each tool and will be placed in the same directory as the directories containing the per-sample profiles.

The following tools will produce multi-sample taxon tables:

  • Bracken (via bracken’s combine_bracken_outputs.py script)
  • Centrifuge (via KrakenTools’ combine_kreports.py script)
  • Centrifuger (via KrakenTools’ combine_kreports.py script)
  • Kaiju (via Kaiju’s kaiju2table tool)
  • Kraken2 (via KrakenTools’ combine_kreports.py script)
  • MetaPhlAn (via MetaPhlAn’s merge_metaphlan_tables.py script)
  • mOTUs (via the motus merge command)
  • ganon (via the ganon table command)
  • sylph (via the sylphtax merge command)

Note that the multi-sample tables from the ‘native’ tools in each folders are not inter-operable with each other as they can have different formats and can contain additional and different data. In this case we refer you to use the standardised and merged output from Taxpasta, as described above.

Generate inputs for downstream pipeline

genomic-medicine-sweden/metaval

genomic-medicine-sweden/metaval is a Nextflow pipeline for validation of taxonomic classifications generated by nf-core/taxprofiler. It assesses whether identified taxa are true or false discoveries by analyzing assigned reads using sequence alignment (BLAST) and reference-based read mapping. At the moment, genomic-medicine-sweden/metaval supports taxa classified by Kraken2, Centrifuge and DIAMOND for both Illumina and Nanopore sequencing data.

metaval needs at a minimum the following files:

  • FASTQ reads (raw, filtered, or after host-removal)
  • One taxonomic classification table
  • One taxpasta table

To generate the required inputs for genomic-medicine-sweden/metaval, include the metaval profile using -profile <your_other_configs>,metaval.

[!DANGER] Do not modify --run_profile_standardisation or --taxpasta_add_lineage. The output files from these flags are mandatory input for metaval.

We generally recommend cleaning up and preprocessing your reads prior passing to metaval.

If you want to filter your short FASTQ input files reads for use in metaval (as in, your reads are not already preprocessed), additionally include --perform_shortread_qc --perform_shortread_complexityfilter --save_complexityfiltered_reads. If you want to filter your long FASTQ input files reads for use in metaval, additionally specify --perform_longread_qc --save_preprocessed_reads,

If you want to remove host reads from short-read input for use in metaval, additionally include --perform_shortread_hostremoval --perform_shortread_hostremoval --save_hostremoval_unmapped --hostremoval_reference '/path/to/host/genome.

If you want to remove host reads from long-read input for use in metaval, additionally include --perform_longread_hostremoval --save_hostremoval_unmapped --hostremoval_reference '/path/to/host/genome'.

By default, the metaval config will turn on all of --run_kraken2 --kraken2_save_readclassifications, --run_centrifuge, and --run_diamond. If you only wish to run one or two, specify --run_<tool> false

Updating the pipeline

When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you’re running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline:

nextflow pull nf-core/taxprofiler

Reproducibility

It is a good idea to specify the pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you’ll be running the same version of the pipeline, even if there have been changes to the code since.

First, go to the nf-core/taxprofiler releases page and find the latest pipeline version - numeric only (eg. 1.3.1). Then specify this when running the pipeline with -r (one hyphen) - eg. -r 1.3.1. Of course, you can switch to another version by changing the number after the -r flag.

This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports.

To further assist in reproducibility, you can use share and reuse parameter files to repeat pipeline runs with the same settings without having to write out a command with every single parameter.

Tip

If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles.

Core Nextflow arguments

Note

These options are part of Nextflow and use a single hyphen (pipeline parameters use a double-hyphen)

-profile

Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments.

Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below.

Important

We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.

The pipeline also dynamically loads configurations from https://github.com/nf-core/configs when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is supported, please see the nf-core/configs documentation.

Note that multiple profiles can be loaded, for example: -profile test,docker - the order of arguments is important! They are loaded in sequence, so later profiles can overwrite earlier profiles.

If -profile is not specified, the pipeline will run locally and expect all software to be installed and available on the PATH. This is not recommended, since it can lead to different results on different machines dependent on the computer environment.

  • test
    • A profile with a complete configuration for automated testing
    • Includes links to test data so needs no other parameters
  • docker
    • A generic configuration profile to be used with Docker
  • singularity
    • A generic configuration profile to be used with Singularity
  • podman
    • A generic configuration profile to be used with Podman
  • shifter
    • A generic configuration profile to be used with Shifter
  • charliecloud
    • A generic configuration profile to be used with Charliecloud
  • apptainer
    • A generic configuration profile to be used with Apptainer
  • wave
    • A generic configuration profile to enable Wave containers. Use together with one of the above (requires Nextflow 24.03.0-edge or later).
  • conda
    • A generic configuration profile to be used with Conda. Please only use Conda as a last resort i.e. when it’s not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer.

-resume

Specify this when restarting a pipeline. Nextflow will use cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously. For input to be considered the same, not only the names must be identical but the files’ contents as well. For more info about this parameter, see this blog post.

You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.

-c

Specify the path to a specific config file (this is a core Nextflow command). See the nf-core website documentation for more information.

Custom configuration

Resource requests

Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the pipeline steps, if the job exits with any of the error codes specified here it will automatically be resubmitted with higher resources request (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped.

To change the resource requests, please see the max resources and customise process resources section of the nf-core website.

Warning

If modifying --krakenuniq_ram_chunk_size or KrakenUniq’s --preload-size parameters in a --databases CSV file, make sure to update your workflow resources for the KRAKENUNIQ/PRELOADEDKRAKENUNIQ process to match the same value! For example, if you set your --krakenuniq_ram_chunk_size to 2G, you should customise your resources with

process {
withName: KRAKENUNIQ/PRELOADEDKRAKENUNIQ {
memory = '2.GB'
}
}

Otherwise by default the pipeline will request 16GB of memory for this process but will only use 2GB of memory.

Custom Containers

In some cases, you may wish to change the container or conda environment used by a pipeline steps for a particular tool. By default, nf-core pipelines use containers and software from the biocontainers or bioconda projects. However, in some cases the pipeline specified version maybe out of date.

To use a different container from the default container or conda environment specified in a pipeline, please see the updating tool versions section of the nf-core website.

Custom Tool Arguments

A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default.

To learn how to provide additional arguments to a particular tool of the pipeline, please see the customising tool arguments section of the nf-core website.

nf-core/configs

In most cases, you will only need to create a custom config as a one-off but if you and others within your organisation are likely to be running nf-core pipelines regularly and need to use the same settings regularly it may be a good idea to request that your custom config file is uploaded to the nf-core/configs git repository. Before you do this please can you test that the config file works with your pipeline of choice using the -c parameter. You can then create a pull request to the nf-core/configs repository with the addition of your config file, associated documentation file (see examples in nf-core/configs/docs), and amending nfcore_custom.config to include your custom profile.

See the main Nextflow documentation for more information about creating your own configuration files.

If you have any questions or issues please send us a message on Slack on the #configs channel.

Running in the background

Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished.

The Nextflow -bg flag launches Nextflow in the background, detached from your terminal so that the workflow does not stop if you log out of your session. The logs are saved to a file.

Alternatively, you can use screen / tmux or similar tool to create a detached session which you can log back into at a later time. Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs).

Nextflow memory requirements

In some cases, the Nextflow Java virtual machines can start to request a large amount of memory. We recommend adding the following line to your environment to limit this (typically in ~/.bashrc or ~./bash_profile):

NXF_OPTS='-Xms1g -Xmx4g'